answer the question 351- College Paper Lab | collegepaperslab.com

College Paper Lab

answer the question 351- College Paper Lab | collegepaperslab.com

a. Transcribe and translate the following template sequence of DNA starting with the first Methionine codon.

DNA Template Sequence

ATATATACAACACAATGTCATCCCCTACT

b. What would be the effect on the protein if the ninth nucleotide is changed from an A to a T?

c. Give the protein sequence for this change.

d. What is this mutation called?

College Paper Lab – Check our website for more...

 

PLACE YOUR ORDER NOW

Disclaimer: It is illegal to use the research material ordered on this website for other than research purposes. You must quote the sources appropriately. The company bears no responsibility for the use of research work, not intended for education use, the work is sold as-is with the highest quality and service available and written by freelancers. #Domyhomework #studygram #essaywriting #paperwriting #academicwriting #homeworkhelp #homeworkhelper #essayhelp #homeworkhelpservice #examtips #onlinedegree #onlineclasses #freelancerwriting #expertwriters #philosophywriters #assignmenthelp #onlineassignmenthelp #assignmenthelpaustralia #programmingassignmenthelp #matlabassignmenthelp #managementassignmenthelp #engineeringassignmenthelp #computerassignmenthelp #civilassignmenthelp #mechanicalassignmenthelp #lawassignmenthelp #nursingassignmenthelp #bestassignmenthelp #myassignmenthelp